Featured Post
A Comparison of Love According to Browning, Dickinson, Shakespeare and Harris :: Comparison Compare Contrast Essays
Love According to Browning, Dickinson, Shakespeare and Harris People are altogether different animals. We express our feelings in an unex...
Thursday, October 31, 2019
Fire Protection Hydraulics and water supply Essay - 2
Fire Protection Hydraulics and water supply - Essay Example Conversely, the elevation pressure must be decreased in order to maintain the level of the forward pressure. These adjustments are done by controlling the flow and turning the nozzle in order to get the elevation pressure required. To relieve the backpressure, the nozzle is turned downward, while in order to relieve the forward pressure, the nozzle is turned upward (Cote, 2003). In a Fire protection system, the backpressure and the forward pressure must be properly controlled in order to maintain a particular quantity of fluid that passes through the nozzle. This is done effectively by controlling the elevation pressure (Cote, 2003). If the backpressure and the forward pressure are not adequately controlled, the fire protection system would definitely not function properly. In essence, the knowledge of the amount of elevation pressure that is required to produce a particular amount of backpressure and forward pressure is of high importance as this would go a long way in making the fire protection hydraulic system more
Tuesday, October 29, 2019
Project Communication Term Paper Example | Topics and Well Written Essays - 250 words
Project Communication - Term Paper Example The first thing we can do is pair people into groups of four, two of each. This lets each person feel they have someone who understands them while having to work with two who are coming from a different place. Second, when were doing user group instruction or teaching, we should again have paired elements. The introverted person can handle some of the electronic communication, while the extroverted person can do some of the speaking portion, but both should be involved at each step. When an introverted developer gets a chance to answer a question about how his programming works, his area of expertise, hell come out of his shell quickly more often than not. Finally, we should use a message board and a wiki. This not only lets us keep up in real time with our user group, but it also lets the introverted people have a chance to discuss in a forum that lets them apply their thinking
Sunday, October 27, 2019
Heteroplasmy and Response Against Azoxystrobin in Cercospora
Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.
Friday, October 25, 2019
Animal Farm Summary :: Animal Farm Essays
The book starts in the barnyard of Mr. Jones' "Manor Farm". The animals gather at a meeting led by the white boar, Major. Major shows them that no animal in England is free. He also explains that the stuff that they produce is taken by man and the animals do not benefit. The only thing that man gives is food to survive so more money can be made off of the animals. Majors lets them know that man is the source of all problems and should be eliminated. He proposes that all of the animals should avoid man's habits. Above all Major says to the animals that they cannot kill one another, that they are all equal.A few days later Major dies, but his message remains in the hearts and minds of the animals. Under the leadership of the pigs, who are clearly the more intelligent of the animals, they strike against their human master and manage to get rid of him. After the rebellion, under the direction of Napoleon, the most outspoken pig, and Snowball, the most articulate pig, the animals continue to work the farm with success.The animals now come up with a set of rules to run their society. They are labeled "the Seven Commandments of Animalism" and are posted on the barn wall. 1. Whatever goes upon two legs is an enemy2. Whatever goes upon four legs, or has wings is a friend.3. No animal shall wear clothes.4. No animal shall sleep in a bed5. No animal shall drink alcohol6. No animal shall kill any other animal.7. All animals are equalThe animals succeed at running the farm for a little while. They finish all of their work with stunning efficiency and every week hold ceremonies to celebrate the rebellion and to plan work. Meanwhile, the pigs as leaders are taking bigger food rations for themselves justifying their behavior as something necessary for the "brains" of their animal society. They explain that it is necessary or else the farmers might come back and take over the farm.The farmers do try to reclaim their tries to reclaim his power but the animals prevent him from doing so in what they call "The Battle of the Cowshed". The conflict between Napoleon and Snowball gets more intense. At every meeting they can never agree on what needs to be done. Napoleon and Snowball fight over whether or not a windmill should be built.
Thursday, October 24, 2019
Progressive Taxation
Progressive taxation rates are unethical and need to be changed. The media likes to say the rich need to pay their fair share and I will show that if everyone paid the same percentage of their income without all the loopholes the current tax system has the government would be better off. This is an ethical issue that needs to be addressed by our current and future leaders to help eliminate the extraordinary amount of debt our country currently has to reimburse. Utilitarianism is that an action is right if it tends to promote happiness and wrong if it tends to produce the reverse of happiness [1].It also involves the happiness of the performer of the action but also that of everyone affected by it. This would lead the current system of progressive taxation since those involved in creating the current tax system believe it is fair to all involved. The poor would see the rich pay a higher percentage of their income to fund the government and the items that they provide. Unfortunately th is country has been using this type of taxation and now it has a tremendous debt to repay. So our current taxation system must not be working if we are not taking in the amount needed to pay our yearly government expenses.Relativism is the belief that everyone has their own version of the solution to the problem. It is also a concept that states points have no truth or validity, but only a subjective value [2]. The discussion of progressive taxation is not one that many people want to change. Everyone that thinks a fair taxation of a flat percentage is afraid it will not promote happiness among those that would have an increase in taxes. This theory would allow us to give the chance to try a flat tax to see if indeed it would increase the income this country generates along with removing tax loop holes allowing some people to avoid paying what they should.My view is more of the relativism type of view. I believe that for our country to avoid a horrible financial crisis we must try t o generate more income and everyone must pay their fair share which would be of an equal percentage of their income. Progression has been in use somewhere in the world for thousands of years. It is safe to say the debate on its merits goes back at least that far. At the present most nations employ some form of progressive taxation. The first time there was a federal income tax it was imposed in 1861 as a means of financing the Civil War.The tax rates were decreased after the war and the income tax was allowed to expire in 1872. The concept of an income tax was controversial so when a new income tax was levied in 1894 it was challenged in the courts. In 1895 it was found to be unconstitutional. It was not until 1913, with the ratification of the 16th Amendment to the Constitution, that the first constitutionally sanctioned income tax was enacted. The first income tax was a progressive tax [3]. Today, we Americans are paying the highest taxes in our nation's history. The current ta x system is complex and includes several inequities.It penalizes those who are married by making them pay higher taxes than single individuals. Many Americans face a death tax that will claim a large portion of their estate after they die. We need to get rid of our confusing, unfair tax code and replace it with a simple flat tax with one rate with no deductions or special interest loopholes [4]. The overly complicated tax code creates an unnecessary burden on all Americans, with an annual compliance cost estimated to be $365 billion. The extensive nine million plus word document is complex and unfair.It inhibits saving, investment, and creating jobs along with imposing a heavy burden on American families. At the same time, the tax code reduces economic growth. The code is so complex with all of the deductions, credits, and other preferences added to the tax code by the special interest lobbyists. It is because of these loopholes, taxpayers with similar incomes can end up paying diff erent amounts in taxes. This uneven treatment of taxpayers is fundamentally unethical and is not part of the American value of equality under the law.The tax code should be replaced with a new code that is simple to understand, has low rates, that is flat and fair. The new flat tax as outlined in Heritage’s ‘Saving the American Dream’ plan, would replace the current tax system with a simple tax system that would allow America to achieve its full economic potential [5]. It has to be honest in order to help promote economic growth. It will do this while removing disparities in the tax code at the same time. The existing tax system is wrong, especially in its complication and its decrease of our economic audacity.The tax system is complex and it is forced upon all taxpayers. The low income must journey thru the extremely hard to understand Earned Income Credit. Those who can save some money must overcome the loss of confidence and go through the hassle of trying to understand the tax rates and manage the different forms of saving. Businesses investing in new equipment must pay extra to get equity capital and must then overcome the tax hurdles added on their vested interests. This results in a deranged tax system which results in a much smaller economy. The need for tax reform is clear.The tax reform proposals such as the traditional flat tax would only solve part of the problem by regenerating or changing the federal individual and corporate income taxes. A new flat tax would replace income taxes, as well as the death tax, payroll taxes and all tariffs not set aside for a trust fund. Under a flat tax taxpayers will handle a single tax. The design of a flat tax is because of the need for a more rational tax system. Unavoidable high tax rates combined with unethical rules have altered the economic decisions of businesses and families. This leaves the economy in a complete weaker position by these perversions.We need a stronger economy and that i s the goal of a flat tax. It would obtain this goal by achieving an economically neutral tax base and by lowering the tax rates. The amount of taxation and the degree of redistribution are questions that will need to be answered and be separate from the primary question of taxation. Simulations have suggested a flat tax would meet this test of generating enough revenue and would leave the allotment of the federal tax load fundamentally unchanged. A better economy would create more jobs, increased wages and greater economic safeness.The economy has enjoyed economic growth in recent decades along with too many recessions and high unemployment. While this has been happening China and India are regularly gaining strength, and America must act to match their rise. Tax reform would be a good place to start in gaining and advance America’s economic strength for the years ahead. The federal tax code is very complicated and hard for most to understand. Thanks to personal computers and tax software it has created an issue with policymakers in Washington to create tax complexities that tax professionals can have issues understanding.There are too many credits, exemptions and deductions and many of them are subject to special rules and only are allowed at certain amounts of income. With all of this complexity individual taxpayers suffer minor compared to the outrageous rules and exceptions businesses suffer thru. As bad as the complexity is the drain on the economic system by our federal tax system is worse. High tax rates have discouraged all levels of productive activity. Our corporate income tax rate is almost the highest in the industrialized world and higher than the average of our international competitors. The economy is further decreased y the existents system’s impulse to overtax saving which means people are discouraged from saving enough for their retirement and for the large investments. This steers consumers toward debt and everyone towards an a bbreviated economic security. These reactions will lead to a depressed level of national savings which will lower investment opportunities. The federal tax system should not be this hard to understand and damaging to the U. S. economy. It is this way because for many decades Congresses have twisted the system often creating two new issues while trying to solve one issue.The income tax has turned to be a bad decision from its outset. After many Congresses it continues to get worse without any exceptions. A stronger economy would be a vital role in advancing the federal finances. This would create better levels of tax revenue and create less spending needs for the unemployed. A strong economy offers increased wages and increased job opportunities to the citizens of our tax base. This would create less poverty and with less poverty comes fewer demands for welfare. A flat tax would be a complete reform of the entire federal tax system as with most previous tax reform proposals.The flat tax can be started as a single tax plan or as part of a more complete rewriting of our government’s federal fiscal policy. A flat tax would offer astounding understanding for individuals and businesses. It would create much greater clarity so that we taxpayers would be more convinced the taxes that are paid are in close to the amount of their neighbors. It will also allow taxpayers to be more informed about the costs of running our government. The flat tax will free the potential for the American economy to grow without being burdened by high tax rates.American taxpayers spend an average of 26. 5 hours processing and preparing their tax returns [6]. However companies and wealthy people hire teams of professionals to play the system. How is that fair? A flat tax treats everybody the same. You don’t have to worry about missing deductions that the other guy is taking. Other countries in the world have adopted the flat tax, even former Communist countries. Why can’t the United States? Those other countries have understood that a flat tax reduces the incentive to play the system.Because of its simplicity and low tax rate, a flat tax encourages people to stop cheating and honestly report their income. They can be assured that both the rich and the poor are paying the same rates and taking the same deductions. We save time and money and make our country more competitive in the world. A flat tax would replace our existing tax system with a very simple single rate system that would only tax individual’s incomes only once, offers businesses with an economical investment-friendly tax, and replace all federal income taxes along with payroll taxes.This will prove that progressive taxation rates need to be eliminated to allow for a fair and balanced tax rate that all Americans can feel is fair. We do not need to be overtaxed, but equally taxed. We need to save our country from bankruptcy and save it so our children’s children will have a p lace to call home. We need to keep America the greatest country in the world without having the future generations force to pay even higher taxes because our government officials can’t stop spending the money they do not have to spend. 1 – www. utilitarianism. com – Stanford Encyclopedia of Philosophy, plato. stanford. edu 3 – Hoover Institution, Stanford University, www. hoover. org/publications/policy-review/article/72291 4 – Freedom Works, www. freedomworks. org/issues/flat-tax 5 – The Heritage Foundation, www. heritage. org/research/factsheets/2012/01/the-new-flat-tax-encourages-growth-and-job-creation 6 – David Keating, A Taxing Trend: The Rise in Complexity, Forms, and Paperwork Burdens (National Taxpayers Union, April 18, 2011), 13. Available at: http://www. ntu. org/news-and-issues/taxes/tax-reform/ntupp130. html (April 20, 2012)
Wednesday, October 23, 2019
The Movie Crash
In the movie, Crash, nearly any racism and discrimination you can think of are shown. In all of these the core problems are lack of civil liberties, rights, social justice, and prejudices from people. This movie did a great job of showing what goes on in certain societies. The main races shown as minorities and being treated wrong were African Americans, Hispanics, and Persians/Asians. Civil rights are defined as, â€Å"The rights of citizens to political and social freedom and equality. †Civil liberties are defined as, â€Å"Guarantees of the safety of persons, opinions, and property from the arbitrary acts of government. Social justices are defined as, â€Å"The application of the concept of justice on a social scale. †Prejudices are defined as, â€Å"An unfavorable opinion or feeling formed beforehand or without knowledge, thought, or reason. †All four of these are heavily shown in Crash. It is unfortunate that these things happen to people, but it is impo rtant to know they do happen and to not treat people like this. African American rights have been a struggle throughout our history, and probably always will be. A major landmark in our process to equality was the Civil Rights Act of 1964. It was an Act in the United States that outlawed some forms of discrimination against African Americans. This act outlawed the segregation of schools, work places, and public areas. It also outlawed unequal voting laws. In the movie, African American discrimination was shown a lot. A scene with car-jacking involving African Americans showed the way that many people view the entire race to behave. There were also scenes with racial profiling and even being ignored at a restaurant. One of the worse scenes showing the discrimination and total loss of equality and rights to all races was a scene where a white police officer pulled over an African American couple for not good reason and proceeded to take full advantage of his situation. He sexually assaulted the woman because he knew they would not report him, seeing that they were a minority. It was really sad to see that the husband had to just watch and couldn’t do anything and I’m sure this sort of thing has really happened before. This is not social justice, and is a lack of both civil rights and liberties. No one should feel like they cannot report a crime because they are the minority in the situation. A real case involving African Americans is Lloyd Gaines, who was denied from a law school in Mississippi because he was black. When taken to Supreme Court, Gaines won the case. This is good news and a step in the right direction. African Americans are discriminated against a lot, as shown in the movie. Hispanics are another group largely discriminated on. The Immigration Reform and Control Act of 1968 was an Act that did not help our equal rights progress through the years. In the movie, we see problems that occur today in the United States dealing with Hispanics. I think that Hispanics are the group most prejudiced against today. In one scene, a white rich woman is getting her locks changed by a company. When the lock changer showed up, she completely stereotyped him noticing his tattoos and baggy clothing. The women did not trust the work of the Hispanic man and wanted the company to re-do the locks. Another scene shows a women disrespecting her Hispanic housekeeper and treating her with no equality. She is rude to the housekeeper and treats her as a minority. The last scene about Hispanics that stood out to me was the scene where the lock worker showed up to change the Persian man’s shop’s locks. When the Hispanic man nicely tries to explain to the man that the door is broken he immediately things the Hispanic man is cheating him. The Persian man was very rude, and was yelling at the worker. Even though the Persian man is later discriminated on, it is no reason to have such a strong prejudice on a man just trying to do his job. In the movie, I didn’t really see any crimes committed to Hispanic people, I definitely saw social injustice but no specific crimes done to them. I think Hispanic discrimination is still a really big problem today and everyone has so many stereotypes for everyone. The last groups of people shown being discriminated against were the Persians, and Asians. Some history behind these groups was the Chinese Immigration Act if 1885. This Act gave a big tax to all Chinese Immigrants in the United States. Today, I’d like to think there is less discrimination on Asians. In one scene, the Persian shop owner wants to buy a gun. The man selling the gun refuses to sell the Persian man because his English is broken. His daughter talks to the man selling the gun and ends up succeeding and purchasing it. It is illegal to not sell a product to someone because of a prejudice view or racial profile. In the end of the movie, we learn that the Chinese man who was ran over by the African Americans was actually selling people of his own race out of his truck for money. This sort of shows that discrimination and lack equality has gotten so bad that even same-race people are doing whatever they can to survive in this Country. African Americans, Hispanics, Persians, and Chinese are all shown being racially profiled, prejudiced, and treated far from equal. None of this, by law, should be happening. It is impossible to control all people all the time, but I think too much of this is happening everyday. In the United States, certain laws are promised and should be completely followed through. It is sad to see all of this discrimination in the movie, but it is good to know it happens so that we can stop it as much as possible, and make more equality for every citizen, no matter their race. The United States has done many good things to put the Country on the right track towards equality, but still decimation exists, and to every race and minority. The Movie Crash In the movie, Crash, nearly any racism and discrimination you can think of are shown. In all of these the core problems are lack of civil liberties, rights, social justice, and prejudices from people. This movie did a great job of showing what goes on in certain societies. The main races shown as minorities and being treated wrong were African Americans, Hispanics, and Persians/Asians. Civil rights are defined as, â€Å"The rights of citizens to political and social freedom and equality. †Civil liberties are defined as, â€Å"Guarantees of the safety of persons, opinions, and property from the arbitrary acts of government. Social justices are defined as, â€Å"The application of the concept of justice on a social scale. †Prejudices are defined as, â€Å"An unfavorable opinion or feeling formed beforehand or without knowledge, thought, or reason. †All four of these are heavily shown in Crash. It is unfortunate that these things happen to people, but it is impo rtant to know they do happen and to not treat people like this. African American rights have been a struggle throughout our history, and probably always will be. A major landmark in our process to equality was the Civil Rights Act of 1964. It was an Act in the United States that outlawed some forms of discrimination against African Americans. This act outlawed the segregation of schools, work places, and public areas. It also outlawed unequal voting laws. In the movie, African American discrimination was shown a lot. A scene with car-jacking involving African Americans showed the way that many people view the entire race to behave. There were also scenes with racial profiling and even being ignored at a restaurant. One of the worse scenes showing the discrimination and total loss of equality and rights to all races was a scene where a white police officer pulled over an African American couple for not good reason and proceeded to take full advantage of his situation. He sexually assaulted the woman because he knew they would not report him, seeing that they were a minority. It was really sad to see that the husband had to just watch and couldn’t do anything and I’m sure this sort of thing has really happened before. This is not social justice, and is a lack of both civil rights and liberties. No one should feel like they cannot report a crime because they are the minority in the situation. A real case involving African Americans is Lloyd Gaines, who was denied from a law school in Mississippi because he was black. When taken to Supreme Court, Gaines won the case. This is good news and a step in the right direction. African Americans are discriminated against a lot, as shown in the movie. Hispanics are another group largely discriminated on. The Immigration Reform and Control Act of 1968 was an Act that did not help our equal rights progress through the years. In the movie, we see problems that occur today in the United States dealing with Hispanics. I think that Hispanics are the group most prejudiced against today. In one scene, a white rich woman is getting her locks changed by a company. When the lock changer showed up, she completely stereotyped him noticing his tattoos and baggy clothing. The women did not trust the work of the Hispanic man and wanted the company to re-do the locks. Another scene shows a women disrespecting her Hispanic housekeeper and treating her with no equality. She is rude to the housekeeper and treats her as a minority. The last scene about Hispanics that stood out to me was the scene where the lock worker showed up to change the Persian man’s shop’s locks. When the Hispanic man nicely tries to explain to the man that the door is broken he immediately things the Hispanic man is cheating him. The Persian man was very rude, and was yelling at the worker. Even though the Persian man is later discriminated on, it is no reason to have such a strong prejudice on a man just trying to do his job. In the movie, I didn’t really see any crimes committed to Hispanic people, I definitely saw social injustice but no specific crimes done to them. I think Hispanic discrimination is still a really big problem today and everyone has so many stereotypes for everyone. The last groups of people shown being discriminated against were the Persians, and Asians. Some history behind these groups was the Chinese Immigration Act if 1885. This Act gave a big tax to all Chinese Immigrants in the United States. Today, I’d like to think there is less discrimination on Asians. In one scene, the Persian shop owner wants to buy a gun. The man selling the gun refuses to sell the Persian man because his English is broken. His daughter talks to the man selling the gun and ends up succeeding and purchasing it. It is illegal to not sell a product to someone because of a prejudice view or racial profile. In the end of the movie, we learn that the Chinese man who was ran over by the African Americans was actually selling people of his own race out of his truck for money. This sort of shows that discrimination and lack equality has gotten so bad that even same-race people are doing whatever they can to survive in this Country. African Americans, Hispanics, Persians, and Chinese are all shown being racially profiled, prejudiced, and treated far from equal. None of this, by law, should be happening. It is impossible to control all people all the time, but I think too much of this is happening everyday. In the United States, certain laws are promised and should be completely followed through. It is sad to see all of this discrimination in the movie, but it is good to know it happens so that we can stop it as much as possible, and make more equality for every citizen, no matter their race. The United States has done many good things to put the Country on the right track towards equality, but still decimation exists, and to every race and minority.
Subscribe to:
Posts (Atom)