The North American Free Trade Agreement - 897 Words

Developing countries tend to be located in the global south wile developed countries are located in the global north. In the 1980s neoliberalism took full swing and focused on an open economic market, and the creation of institutions. It created the Bretton Woods institutions in order to spread American values and promote economic growth through privatization of state owned enterprises. â€Å"The last 25 years has seen the most rapid, and most broad-based, growth in developing countries, ever† (Dervis, Kharas). Globalization has facilitated the spread of neoliberal ideology across the globe through an economic international trading system. For example, the North American Free Trade Agreement (NAFTA) with regional partners, such as Mexico, promoted an open approach to the economy and provided important benefits for both countries. Another example, was the creation of the World Trade Organization (WTO) that includes over a hundred countries. Globalization has been accompanied by terrorism and economic inequality. Many critics of globalization argue that the western model for development has failed to anticipate and act on the previously mentioned issues. There have been positive and negative outcomes from globalization and trade agreements. Some of the negative outcomes have been environmental degradation and inequality. There has been unsustainable growth partly because environmental degradation has been coupled with economic growth. The measurements of GDP and growth of incomeShow MoreRelatedNorth American Free Trade Agreement Essay1398 Words   |  6 Pages North American Free Trade Agreement During the most recent race for the White House we heard very little of substance from both parties, but one thing both parties seem to agree on is that free trade has been bad for the U.S. worker. One candidate proclaimed that the North American Free Trade Agreement (NAFTA) has cost the United States hundreds of thousands of jobs and another distanced herself from free trade agreements all together. It has been over twenty years since the implementation ofRead MoreThe North American Free Trade Agreement1711 Words   |  7 PagesThis paper will discuss four components of the North American Free Trade Agreement: Background, events, pros and cons. Upon the research, you will discover four online articles to provide more detail and examples. This research will indicate how it was developed and the reasoning on why it would benefit the nation. Also, it will provide events that occur after the agreement was signed by congress and the recession the countries experience during the e arly 2000s. There will be a chart locatedRead MoreThe North American Free Trade Agreement Essay1420 Words   |  6 Pagessubstance from both parties, but one thing both parties seem to agree on is that free trade has been bad for the U.S. worker. One candidate proclaimed that the North American Free Trade Agreement (NAFTA) has cost the United States hundreds of thousands of jobs and another distanced herself from free trade agreements all together. It has been over twenty years since the implementation of the North American Free Trade Agreement and many have criticized it as a bad deal for the U.S. It can be shown thatRead MoreThe North American Free Trade Agreement1036 Words   |  5 PagesThe North American Free Trade Agreement also referred to as NAFTA produced results on January 1, 1994. A trade agreement was made between each of the three of nations of North America. The United States, Canada, and Mexico. The Canadian Prime Minister, Brian Mulroney, the Mexican Presiden t, Carlos Salinas de Gortari, and previous U.S. President George H. Shrub initiated the agreement. Connections between the nations were at that point on great terms, particularly between The United States and CanadaRead MoreThe North American Free Trade Agreement Essay1863 Words   |  8 PagesThe North American Free Trade Agreement, or NAFTA, is an accordance between the United States, Mexico, and Canada that was put into effect in January 1994. This agreement was unprecedented because it integrated three countries that were at extremely different levels of economic development. It changed the economic relationship between North American countries and encouraged trade and investment among the three countries to grow considerably. The purpose of the creation of the North American FreeRead MoreThe North American Free Trade Agreement Essay1356 Words   |  6 PagesThe North American Free Trade Agreement (NAFTA) is an agreement negotiated by three countries; Canada, Mexico, and the United States. The main purpose of NAFTA is essentially to reduce trade barriers in order to promote international commerce, and open up different industries to trade, in particular textiles, agriculture, and automobile sectors. The introduction of NAFTA completely transformed North American economic relations and led to unparalleled cooperation between the U.S. Canada and MexicoRead MoreThe North American Free Trade Agreement1486 Words   |  6 PagesThe North American Free Trade Agreement (NAFTA), an agreement signed by three countries in creating rules in trade in North America. NAFTA, when being presented, was described as genuine for helping Mexico and Canada. But was NAFTA really helpings those counties or really just helping N orth America? Initially North America was being genuine about NAFTA when talking to Mexico and Canada but in reality the NAFTA caused some uneven development as the years went by. I have two stories thatRead MoreThe North American Free Trade Agreement1804 Words   |  8 Pagesunderstanding the elements of trade blocs that enable open markets between member nations while also decreasing the cost of conducting business within a country is essential in making strategic logistical decisions. The North American Free Trade Agreement (NAFTA) has provided one such trade bloc that encompasses the countries of the United States, Mexico, and Canada. Since the inception of NAFTA in 1994, significant financial results have been achieved regarding increases in trade revenue and increases inRead MoreThe North American Free Trade Agreement1018 Words   |  5 PagesThe North American Free Trade Agreement, known as NAFTA, is a trilateral trade agreement between Canada, the United States, and Mexico. Signed January 1, 1994, NAFTA’s main purpose was to reduce trading costs, increase business investments, and help the United States be more competitive in the g lobal marketplace. The agreement would eliminate all tariffs on half of all U.S. goods shipping to Mexico and introduce new regulations to encourage cross-border investments. According to President Bush, tradeRead MoreThe North American Free Trade Agreement920 Words   |  4 PagesThe North American Free Trade Agreement (NATFA) shoved the American worker down a flight of stairs in the name of Globalization NAFTA or a bill similar had been floating around Washington since 1979 a year before Reagan took office. NAFTA truly went no where for over a decade. The â€Å"North American Accord† was first proposed by the Reagan and the GOP were always in favor of passage but, it was the Progressive wing, along with many other pro-union members in the Democratic party who held NAFTA at

Lord Of The Flies Bullying Essay - 932 Words

In William Goldings Lord of the Flies, the audience witness multiple acts of bullying. In the beginning of the book, when Ralph and Piggy first met they didnt get along well. Ralph was calling Piggy names and making fun of how he was called Piggy. Piggy of course was hurt by this and didnt appreciate how Ralph did this to him. When kids bully each other over devices, I think that that the parents and teachers should work together and try to figure out what is happening and resolve the problem working as a team. But all together it should be the parents job. They could make sure that they are thoroughly checking their kids phone and to make sure that their kids are open to them and ready to talk about anything they need.†¦show more content†¦Bullies start at a young age and carry on, this helps them feel good about what they are doing and who they are as a person. The only way to make a difference and try to stop bullying and cyberbullying is if the parents are there to hel p. â€Å"Parents of bullies are advised to take the problem seriously, looking for the causes of anger or frustration, letting them know that hurtful behavior will not be tolerated, supervising their behavior more closely, â€Å"punishing†bullying with positive acts toward others and teaching nonviolent ways of solving problems.† (PERSONAL HEALTH pg. 3) This illustrates that not only the school and parents but the community to must collaborate to control bullying. Parents need to supervise their children on social media and all places in their life, until the children can understand that this is not okay and that we can stand up to bullying. Bullying and cyberbullying can lead to serious causes to the victims and everyone around them. â€Å"It is found that children who bully are at risk for engaging in more serious violent acts, like fighting frequently and carrying weapons.† (PERSONAL HEALTH pg.) This proves that the actions of the bullies are long term effe cts. If someone is to hurt themselves or one another because of how someone made them feel not only will those certain people be hurting inside but the other family and friends in their lives. All of this combined shows that people do bully andShow MoreRelatedLord of the Flies: Bullying Essay1536 Words   |  7 PagesSimilarities of Bullying How long has bullying been around? Bullying has lasted for decades now. It takes no effort to see that in the timeless novel Lord of the Flies, by William Golding, bullying is expressed throughout the book in many different ways. The three forms of bullying readers witness throughout the book consist of verbal bullying, physical bullying, and relational bullying. Although Lord of the Flies takes place nearly sixty years ago, from Golding shows readers that bullying hasn’t changedRead MoreTheme Themes In Lord Of The Flies716 Words   |  3 Pages Golding Theme Essay The author of the book Lord of the Flies, William Golding published this loss of innocence fiction novel post World War II. During this time, the Nazi’s were being heavily criticized by the public for supporting Hitler’s evil ways. In this allegory Golding’s central theme is depicted in this excerpt, â€Å"It was simply what seemed sensible for me to write after the war when everyone was thanking God we weren’t Nazis† (Golding). This theme is an accurate representation of the storyRead MoreRalph, Jack, Piggy -Lord of the Flies1560 Words   |  7 PagesRalph, Jack and Piggy, the three main characters in the Lord of the flies encounter with each of their different personalities. Despite their similar ages, they take distinct reaction towards their situation because of their different growing environment. In this isolated and uncivilized island especially with no grown-ups, the development of their characteristics varies in different directions. When the events burst out one by one in chapter one to three, we can discover the contrast between RalphRead MoreStephen P. Robbins Timothy A. Judge (2011) Organizational Behaviour 15th Edition New Jersey: Prentice Hall393164 Words   |  1573 PagesDeveloping an OB Model 23 An Overview 23 †¢ Inputs 24 †¢ Processes 25 †¢ Outcomes 25 Summary and Implications for Managers 30 S A L Self-Assessment Library How Much Do I Know About Organizational Behavior? 4 Myth or Science? â€Å"Most Acts of Workplace Bullying Are Men Attacking Women† 12 An Ethical Choice Can You Learn from Failure? 24 glOBalization! Does National Culture Affect Organizational Practices? 30 Point/Counterpoint Lost in Translation? 31 Questions for Review 32 Experiential Exercise WorkforceRead MoreFundamentals of Hrm263904 Words   |  1056 Pagesif you live in Frostburg, Maryland, and decide to go to a Florida beach for two weeks in the summer, you need to decide specifically what beach—Daytona or Fort Lauderdale—you want to go to and the best route you can take. Will you drive or will you fly? Will you rent a hotel room or stay with a friend? In an elementary form, this is what planning is all about—knowing where you are going and how you are going to get there. The same holds true for human resource management. Whenever an organization

Information Systems and Accounting Processes Different Transactions

Question: Describe about the Information Systems and Accounting Processes for Different Transactions. Answer: Introduction This report is based on accounting and financial management of Adelaide ltd. This report is divided into two parts and each part has different concern. In this report discussion related to revenue recognition and cash flow statement has been conducted. In this report, different transactions have been stated and whether they will be recognized or not were discussed. On the other hand, cash flow statement has been prepared in the part B of this report. Cash flow statement shows inflow and outflow of cash in the business organization. Operating activity, financing activities and investing activities are important aspects of cash flow statement. Revenue Recognition: Revenue recognition is the process of recording revenue earned by the business organization during the reporting period. There is dedicated accounting standard for that deals with revenue recognition. Australian Accounting Standard Board has made standard for recognizing revenue in the financial statements of the business organization. Australian Accounting Standard Board 118 is the revenue recognition accounting standard under which related rules and regulation has been provided. It deals with all term and conditions that shall be fulfilled for recognizing revenue in the financial statement or in income statement (Wagenhofer, 2014). Therefore business entity wants to record revenue (sales revenue, revenue from sale of assets, lease revenue, etc) has to fulfill certain conditions. Following are some case in which revenue recognition is tested: This is the case of revenue recognition of sale of goods during the reporting period. Business entity cannot recognize revenue from sales as and when sale takes place. But there are certain conditions that shall be fulfilled in order to recognize sales revenue. Following are conditions to be satisfied: All the risk and rewards related to ownership of good has been transferred to its buyer Amount of sales made can be measured reliably Business organization will be receiving all the economic benefits related to transaction of sale on probable basis Cost related to transaction of sales can be reliably measured Business entity does not possess with any control over product and does not has managerial involvement related to product that is sold (Wagenhofer, 2014). In present case of Adelaide Ltd, sale of $ 600,000 has been affected during the year. Out of $ 600,000, 75 % i.e. $ 450,000 has been received and remaining sales will on credit. On the other hand, past experience suggests that it is probable that 96 % of the sales made will be collected. Therefore by applying able conditions on Adelaide Ltd case, it can be said that it is estimated that that only 96 % sales will be received and all other conditions remains fulfilled. Adelaide Ltd can recognize $ 576,000 ($ 600,000 * 96 %) of sales revenue in its books of accounts. In this case Adelaide Ltd had received $ 200,000 from a customer for the manufacturing of special purpose machinery. In order to recognize revenue all five conditions mentioned above shall be fulfilled and if any one or more conditions not fulfilled then business entity cannot book revenue. In this case of Adelaide Ltd, following two conditions are not fulfilled in this transaction and they are as follows: In this transaction all the risk and rewards related to product (in this case is special purpose machinery) is not transferred to buyer or customer in this case. At this point of time product is not in existence. Another reason of not recognizing this as revenue of the Adelaide Ltd is that at this point of time Adelaide Ltd holds control over product that they produce for customer and has been involved with product that is to be produced. Other conditions may get fulfilled but these two conditions are not attracted (Savage et al., 2013). Therefore advance received customer cannot be recognized as revenue for the reporting period. In this case Adelaide Ltd has rented spare space of warehouse and has received advance payment of $ 24,000 on 1st April, 2016 for next six months period. In this case it can be analyzed that this transaction cannot be treated as sale of goods and above mentioned five conditions cannot be used to comment on revenue recognition. As renting of spare space in warehouse is not ordinary activity of Adelaide Ltd. This case can be treated as revenue arises from use of assets of the company by others during the year. Following conditions should be fulfilled to recognized revenue from rendering warehouse: Amount of sales made can be measured reliably Business organization will be receiving all the economic benefits related to transaction of sale on probable basis Therefore applying above two conditions on Adelaide Ltd, amount of renting service is certain and Adelaide Ltd will be receiving such amount from customer. Therefore rent received can be recognized in the financial statement in income statement as income from other sources with $ 12,000 (for 3 months) and in balance sheet as advance rent with $ 12,000 amount (for 3 months). In this case, Adelaide Ltd had received shares from and of Melbourne ltd (client of Adelaide ltd) as a gift. Now question arises whether this transaction will be recorded in books of accounts or not. For this purpose, if gift received is tangible and resalable in the market then it should be recorded in the books of accounts. In case of Adelaide ltd they are in receipt of shares which is tangible and can be sold in the market. Therefore theses shares received shall be recorded in the books of accounts at fair market value at the point when it is received. Under this case of Adelaide Ltd, they had received equipment in exchange of creditor account. Under this transaction Adelaide Ltd has gained equipment i.e. asset and loose creditor account balance of $ 3,000. In this case, exchange asst (i.e. equipment) will be recorded on fair value of asset and if any loss or profit will be transferred to profit and loss account or income statement prepared during the year (Savage et al., 2013). Therefore following is the transaction and different heads of financial statements of Adelaide Ltd will be affected with this transaction: In balance sheet equipment (asset) received in the transaction will be recorded with fair value of asset i.e. $ 3,200. Debtor account or customer account will be credited with its balance sheet amount i.e. $ 3,000. At last profit made on exchange transaction shall be recorded in profit and loss account as profit made on exchange on transaction. Following is the journal entry Particulars Dr. / Cr. Amount Equipment (Asset) account Dr. $ 3,200 Debtor or Customer account Cr. $ 3,000 Profit on exchange of accounts Cr. $ 200 Statement of cash flow A: Prepare a cash flow statement using the direct method Cash flow statement As at 30 June PARTICULARS AMOUNT Cash flow from operating activities Cash received from customers or collection $272,000 Calculation of cash payment to supplier ($219,000) Selling expenses ($20,000) Administrative expenses ($9,000) Interest expenses ($7,000) Income tax payments ($1,000) Net cash flow from operating activities $16,000 Cash flow from Investing Activities Sale of equipment Purchase of new equipments ($7,000) Net cash flow from investing activities ($7,000) Cash flow from Financing Activities Issue of bonds $10,000 Dividend paid ($26,000) Net cash flow from Financing activities ($16,000) Net Increase or decrease in cash and cash equivalents ($7,000) Cash and cash equivalents at beginning of period $33,000 Cash and cash equivalents at end of period $26,000 (Alin-Eliodor and Traian-Ovidiu 2013) WORKING NOTE Calculation of cash receipt from customers Net sales + beginning accounts receivable Closing accounts receivable $ 286,000 + $ 14,000 $ 28,000 = $ 272,000 Calculation of cash payment to supplier Purchase + closing stock of inventories beginning stock of inventories + beginning accounts payables Closing accounts payables COGS = Purchase + beginning stock of inventories closing stock of inventories $ 194,000 = Purchase + $ 25,000 $ 38,000 Purchase = $ 194,000 - $ 25,000 + $ 38,000 = $ 207,000 Cash payment to supplier = $ 207,000 + $ 38,000 - $ 25,000 + 43,000 - $ 31,000 Cash payment to supplier = $ 232,000 Calculation of selling expenses Selling expenses depreciation expenses Selling expenses = $ 28,000 - $ 8,000 = $ 20,000 Interest expenses for the year = $ 7,000 Administrative expenses for the year = $ 9,000 Income tax payments = Beginning income tax payable ending income tax payable + income tax expenses Income tax payments = $ 20,000 - $ 26,000 + 7,000 Income tax payments = $ 1,000 B: Prepare reconciliation between profit and cash provided by operating activities. Particulars Amount Net profit $ 41,000 Depreciation $ 8,000 Change in working capital ($ 33,000) $ 16,000 (Bhandari and Iyer, 2013) Working note: Calculation of change in working capital Particulars Amount Increase in accounts receivable ($ 14,000) Increase in inventory ($ 13,000) Decrease in accounts payable ($ 12,000) Increase in income tax payable $ 6,000 Change in working capital ($ 33,000) Conclusion It can be concluded that management of organisation shall be aware about revenue recognition so that financial statements of business organisation shall reflect true and fair information. There are different conditions that shall be fulfilled by business transaction for the recognition as revenue in books of accounts. From this report it can be analysed that cash flow statement presents flow of cash in the business organisation. Every business undertakes three major activities and cash flow statement analyses flow of cash from these activities. These activities are operating, investing and financing. References Bhandari, S.B. Iyer, R. 2013, "Predicting business failure using cash flow statement based measures", Managerial Finance, vol. 39, no. 7, pp. 667-676. Alin-Eliodor, T. Traian-Ovidiu, C. 2013, "Presentation of Consolidated Statement of Cash Flows under IAS 7, Statement of Cash Flows", Journal of Knowledge Management, vol. 3, no. 1, pp. 118-133. Wagenhofer, A. 2014, "The role of revenue recognition in performance reporting", Accounting and Business Research, vol. 44, no. 4, pp. 349-379. Savage, A., Cerf, D. Barra, R.A. 2013, "Accounting for the Public Interest: A Revenue Recognition Dilemma", Issues in Accounting Education, vol. 28, no. 3, pp. 691.

The feeling of Dead Society Poets Essay Example For Students

The feeling of Dead Society Poets Essay It Is a good movie for many stereotype teachers and parents to think about themselves. Although the final result of this movie is an unexpected tragedy, I believe that Mr.. Keating got a perfect success when most of the students stood on the desk; the respectful teacher is their captain In their whole life. He makes the students know what life is, to help more young people to find his own. Students set up Dead Poets Society to release themselves. Also, I believe that most of the students Like the teacher such as Mr.. Keating In nowadays. He encouraged confidence and enthusiasm, I hope that I can find myself, and do the best of myself with his Inspiration, and suck out all the marrow of life. However, he forgot to teach his students how to become brave enough to fight for their dreams or beautiful things. He should say: Never give up, just stand up and always keep smiling. You can become a fighter. Seeing the students named Neil dying for his dreams, I was reminded that my arenas seldom asked me to do things I had no interested in my past. We will write a custom essay on The feeling of Dead Society Poets specifically for you for only $16.38 $13.9/page Order now When I saw Nils father, a stubborn man, never allow Neil to act in the play which Neil like most. He is a man, not a product. How cans he stands being made into shapes as products? He has his own life and interested. No one is born to make another happy, we are born to make ourselves happy and enjoy the sweetie of the dreams we have in our heart. However, One of his classmates called Carbon said the teacher encouraged Neil should seek for his dream. Mr.. Keating should be blamed; actually I think not his fault but Nils father, his father arranged Nils life and his future, I think he was the person should be responsible for the Nils died. At last, I like this words I went to the woods because I wished to live deliberately. I wanted to live deep and suck out all the morrow of life, and not when I had come to die, discovered that I had not lived. I seize all the students can find out the meaning of life and do what they Interested in, what they like.

The foundations of environmentalism essays

The foundations of environmentalism essays FINAL ESSAY- THE FOUNDATIONS OF ENVIRONMENTALISM John Muir was one of the first preservationists. He strongly believed that the land as a whole should not be touched by man and that the worlds resources should not be greedily spent. He felt that it was his job to live the way that he felt god would. When he was a young man, he was blinded by an accident in the factory he was working in. After he made a miraculous recovery, he promised to himself that he would seek out the wilderness, and see the world as it should be. He founded the Sierra Club, an organization dedicated to preserving the wilderness. No dogma taught by the present civilization seems to form so insuperable an obstacle in a way of a right understanding of the relations which culture sustains as to wilderness, as that which declares that the world was made especially for the uses of men. Every animal, plant, and crystal controverts it in the plainest terms. Yet it is taught from century to century as something ever new and precious, and in the resulting darkness th e enormous conceit is allowed to go unchallenged. Gifford Pinchot was the only son of a rich New York family. His parents were regular guests at the White House, and his mother and father pushed him to be very successful. At the time, forestry as a career was unheard of, but his father pushed him to try new things, so he started studying forestry. He was the first to try selective logging, leaving the very young trees and the very old trees and taking the middle aged ones. He believed that one could still enjoy nature while using some of its resources, and that nature could be improved for the public good. World-wide practice of Conservation and the fair and continued access by all nations to the resources they need are the two indispensable foundations of continuous plenty and of permanent peace. Aldo Leopold, an ecologist, naturalist, and conservationist, was born i...

Introduction to Chinas May Fourth Movement

Introduction to China's May Fourth Movement The demonstrations of the May Fourth Movement (ä ºâ€Ã¥â€ºâ€ºÃ© â€¹Ã¥â€¹â€¢, WÇ”sà ¬ Yà ¹ndà ²ng) marked a turning point in China’s intellectual development which can still be felt today. While the May Fourth Incident occurred on May 4, 1919, the May Fourth Movement began in 1917 when China declared war against Germany. During World War I, China supported the Allies on the condition that control over Shandong Province, the birthplace of Confucius, would be returned to China if the Allies triumphed. In 1914, Japan had seized control of Shandong from Germany and in 1915 Japan had issued 21 Demands (ä ºÅ'Ã¥  Ã¤ ¸â‚¬Ã¥â‚¬â€¹Ã¦ ¢ Ã©  â€¦, Èr shà ­ yÄ «gà ¨ tio xing) to China, backed by the threat of war. The 21 Demands included recognition of Japan’s seizure of German spheres of influence in China and other economic and extraterritorial concessions. To appease Japan, the corrupt Anfu government in Beijing signed a humiliating treaty with Japan by which China acceded to Japan’s demands. Though China was on the winning side of World War I, China’s representatives were told to sign away rights to German-controlled Shandong Province to Japan at the Treaty of Versailles, an unprecedented and embarrassing diplomatic defeat. The dispute over Article 156 of the 1919 Treaty of Versailles became known as the Shandong Problem (Ã¥ ± ±Ã¦  ±Ã¥â€¢ Ã© ¡Å', ShÄ ndÃ… ng Wà ¨ntà ­). The event was embarrassing because it was revealed at Versailles that secret treaties had been previously signed by the great European powers and Japan to entice Japan to enter World War I. Moreover, it was brought to light that China had also agreed to this arrangement. Wellington Kuo (é ¡ §Ã§ ¶ ­Ã©Ë†Å¾), China’s ambassador to Paris, refused to sign the treaty. The transfer of German rights in Shandong to Japan at the Versailles Peace Conference created anger among the Chinese public. The Chinese viewed the transfer as a betrayal by the Western powers and also as a symbol of Japanese aggression and of the weakness of the corrupt warlord government of Yuan Shi-kai (è ¢ Ã¤ ¸â€"å‡ ±). Infuriated by China’s humiliation at Versailles, college students in Beijing held a demonstration on May 4, 1919. What was  the May Fourth Movement? At 1:30 p.m. on Sunday, May 4, 1919, approximately 3,000 students from 13 Beijing universities assembled at the Gate of Heavenly Peace at Tiananmen Square to protest against the Versailles Peace Conference. The demonstrators distributed fliers declaring that the Chinese would not accept the concession of Chinese territory to Japan. The group marched to the legation quarter, the location of foreign embassies in Beijing, The student protestors presented letters to foreign ministers. In the afternoon, the group confronted three Chinese cabinet officials who had been responsible for the secret treaties that encouraged Japan to enter the war. The Chinese minister to Japan was beaten and a pro-Japanese cabinet minister’s house was set on fire. The police attacked the protestors and arrested 32 students. News of the students’ demonstration and arrest spread throughout China. The press demanded the students’ release and similar demonstrations sprung up in Fuzhou. Guangzhou, Nanjing, Shanghai, Tianjin, and Wuhan. Shop closings in June 1919 exacerbated the situation and led to a boycott of Japanese goods and clashes with Japanese residents. Recently-formed labor unions also staged strikes. The protests, shop closings, and strikes continued until the Chinese government agreed to release the students and fire the three cabinet officials. The demonstrations led to a full resignation by the cabinet and the Chinese delegation at Versailles refused to sign the peace treaty. The issue of who would control Shandong Province was settled at the Washington Conference in 1922 when Japan withdrew its claim to Shandong Province. The May Fourth Movement in Modern Chinese History While student protests are more common today, the May Fourth Movement was led by intellectuals who introduced new cultural ideas including science, democracy, patriotism, and anti-imperialism to the masses. In 1919, communication was not as advanced as today, so efforts to mobilize the masses focused on pamphlets, magazine articles, and literature written by intellectuals. Many of these intellectuals had studied in Japan and returned to China. The writings encouraged a social revolution and challenged traditional Confucian values of familial bonds and deference to authority. The writers also encouraged self-expression and sexual freedom. The period of 1917-1921 is also referred to as the New Culture Movement (æâ€" °Ã¦â€"‡åÅ'â€"é â€¹Ã¥â€¹â€¢, XÄ «n Wà ©nhu Yà ¹ndà ²ng). What started as a cultural movement after the failure of the Chinese Republic turned political after the Paris Peace Conference, which gave German rights over Shandong to Japan. The May Fourth Movement marked an intellectual turning point in China. Collectively, the goal of scholars and students was to rid the Chinese culture of those elements which they believed had led to China’s stagnation and weakness and to create new values for a new, modern China.

Art appreciation Essay Example | Topics and Well Written Essays - 1750 words

Art appreciation - Essay Example This activity provided steady employment for many architects and sculptors who organized leading workshops in Greece, revolutionizing Greek classical art and architecture. The Parthenon, built by Menesicles and Ictinus, along with the Propylaea (the gateway with the finest paintings and sculpture of the Classical age) crowned the Athenian Acropolis. Other prominent works included The Panhellenic shrines, Delphi (oracle of Apollo) and Olympia (the shrine of Zeus). Delphi (460 BC) is the athlete offering libation of oil from patera (sacrificial bowl) in thanks for victory1. Ancient Greece produced some of the most exquisite sculptures the world has ever seen. The art reminiscence the freedom of movement, expression, and celebrates mankind as an independent entity. The great artisans of that period worked tirelessly to show the world what artistry could do for mankind. They replaced the strict asymmetry of figures with the free flowing form more true to life, through stone and bronze. The Greeks were fond of their history and most of the sculptures that adorned important government and other prominent buildings were those of the Kouros. Kouros statues dominated the archaic period of Greek Art. These statues were reminders of great Greek men and women who lived and died a popular figure. Most of these statues were stark reminders of those who died centuries ago and remain immortal through their artistic brilliance (Greeklandscapes.com, 2007). During the Classical period the charismatic smile that dominated so many archaic sculptures was replaced by a solemn facial expression. Sculptures which depicted violent and passionate scenes betrayed no expression, for the Greeks, their nobles were next to God, and it was their enemies (the barbarians) who were depicted with dramatic facial expressions (Greeklandscapes.com, 2007). This bronze

Week 1 discussion questions-Marketing Essay Example | Topics and Well Written Essays - 500 words

Week 1 discussion questions-Marketing - Essay Example For instance, if a company is attempting to increase its sales volume on its hairspray line, the company must understand what makes the customer want their brand over the competition. If a noticeable trend exists which indicates that consumers have stopped buying a firms product, they must understand what factors (both internal and external) have created this sales slump. Are consumers not buying because they believe their friends have suddenly begun demanding high dollar hair products? These are important factors to consider, as a company must routinely monitor trends in buying behavior to provide a product which consumers will adopt. Competitive techniques to appeal to sophisticated customers include visually appealing, contemporary promotional advertisements and continuous monitoring of various trends in consumption. Using modern appeal, such as advertising on portable technology and the internet, are attempts to capture increased interest in complex markets. 2. What are three aspects of your lifestyle that are different than your parents’ lifestyle? What impact does this difference have on the strategies organizations use to market to you compared to your parents? The primary difference in lifestyle would consist of the methods by which we socialize and view our friendships. My parents are more traditional in their viewpoint regarding what constitutes a quality relationship, believing in the comfort of long-term acquaintances. In opposite respect, I tend to be more spontaneous, willing to make many new friends in the pursuit of finding more excitement through social activities. An additional difference includes my current financial situation, which is substantially lower than that of my parents. Further, my parents are more laid-back, content with a lifestyle consisting of the majority of their time spent at home. In opposite respect, I enjoy a more active

Tour Operations Essay Example for Free

Tour Operations Essay Aim and purpose The aim of this unit is to develop learners’ understanding of the dynamic and challenging world of tour operations and for them to appreciate the variety of tour operators’ products and services. Learners will gain knowledge of how tour operators plan, sell and administer a package holiday programme and will also develop practical skills to plan and cost a package holiday. Unit introduction Every year millions of people turn to tour operators to provide them with holidays to all corners of the world. In this unit learners will explore how tour operators link with different types of travel and tourism organisations to provide a wide range of holiday experiences. They will see that tour operators must respond to legislation and external influences, and also face many challenges in the constantly changing travel and tourism sector. Learners will investigate these challenges and the ways in which tour operators respond to them. Tour operators are at the forefront of the travel and tourism sector, constantly seeking out new destinations and holiday experiences to satisfy the ever-demanding and ever-changing needs of today’s holidaymakers. Different types of tour operators will be identified and learners will examine how they develop an extensive portfolio of products and services to meet differing customer needs. Whatever their size, tour operators must work through the same processes when planning, developing, selling and operating their holiday programmes. These different functions will be examined and time scales identified. Learners will find that tour operators compete in a commercially sensitive environment and they will identify how commercial considerations inform many of the business practices. Practical skills will be developed in the planning and costing of a tour operator’s package holiday, allowing learners to appreciate some of the commercial decisions to be made in this competitive industry. Learning outcomes On completion of this unit a learner should: Understand the tour operations environment Know the range of products and services offered by tour operators for different target markets Know how tour operators plan, sell, administer and operate a package holiday programme Be able to plan and cost a package holiday. Unit content 1 Understand the tour operations environment Links with other component industries: travel agents; transport providers; accommodation providers; providers of ancillary products and services eg insurance, car hire; horizontal and vertical integration Links with trade and regulatory bodies: The Travel Association (ABTA); Federation of Tour Operators (FTO); Association of Independent Tour Operators (AITO); UKInbound; Civil Aviation Authority (CAA) Legal framework: EU Package Travel Regulations; consumer protection eg Trades Description Act, Consumer Protection Act, Disability Discrimination Act; contract law; licensing eg Air Transport Operators Licence (ATOL) External influences: environmental eg hurricanes, floods; political eg terrorism, strikes. taxes; economic eg currency fluctuations, price of oil; social eg UK demographics, exploitation in host country; technological eg internet, computerised reservation systems Challenges: eg dynamic packaging, distribution channels, integration, budget airlines, maintaining market share, trend towards independent travel, responsible tourism 2 Know the range of products and services offered by tour operators for different target markets Tour operator categories: outbound; inbound; domestic; specialist; mass market Products and services: components of standard package; tailor made; range of destinations; accommodation choices; transport options; ancillary products and services Target market: eg families, couples, solo travellers, specific age groups, special interests, people with specific needs 3 Know how tour operators plan, sell, administer and operate a package holiday programme Planning: research; forecasting; product development; methods of contracting; costing the package; data input; timescales Sell: brochure production; pricing strategies; distribution eg travel agents, internet, direct sell; promotions eg advertising, sales promotions, sponsorship; reservations; commission; late sales Administer: confirmations; rooming lists; passenger manifests; errata; cancellations; amendments; travel itineraries; ticketing Operations: consolidations; load factors; over-bookings; transport operations; duty office; UK and overseas resort liaison; health and safety; emergency situations; crisis management; quality control; customer service (pre-, during and post-holiday); excursion sales Commercial considerations: maximising profitability; links to different planning, selling, administrative and operational functions 4 Be able to plan and cost a package holiday Plan: destination; transport; accommodation; excursions (included, optional); activities; additional services Cost a package holiday: using load factors; mark-up or profit margin; currency conversions; fixed costs; variable costs Assessment and grading criteria In order to pass this unit, the evidence that the learner presents for assessment needs to demonstrate that they can meet all the learning outcomes for the unit. The assessment criteria for a pass grade describe the level of achievement required to pass this unit. Assessment and grading criteria To achieve a pass grade the evidence must show that the learner is able to: To achieve a merit grade the evidence must show that, in addition to the pass criteria, the learner is able to: M1 discuss the impact of challenges facing tour operators To achieve a distinction grade the evidence must show that, in addition to the pass and merit criteria, the learner is able to: D1 evaluate the effectiveness of tour operators in responding to challenges facing the sector recommend, with justification, how a selected tour operator could expand its range of products and services for its current target market or adapt its range of products and services to appeal to a new market. P1 explain the tour operations environment and the challenges it faces P2 describe the products and M2 analyse how a selected services provided by different tour operator’s portfolio categories of tour operator of products and services for different target markets meets the needs of its target market(s) D2 P3 outline how tour operators plan, sell, administer and operate a package holiday programme, identifying commercial considerations plan and cost a package holiday for inclusion in a tour operator’s programme [CT 1, CT 2, CT 3, CT 4, CT 5, CT 6]. M3 explain ways of maximising profitability during the different stages of planning, selling, administering and operating a package holiday. P4 PLTS: This summary references where applicable, in the square brackets, the elements of the personal, learning and thinking skills applicable in the pass criteria. It identifies opportunities for learners to demonstrate effective application of the referenced elements of the skills. Key IE – independent enquirers CT – creative thinkers RL – reflective learners TW – team workers SM – self-managers EP – effective participators Essential guidance for tutors Delivery It is likely that learners will have already identified the role of tour operators when examining the structure of the UK travel and tourism sector in Unit 1: Investigating the Travel and Tourism Sector. A simple recap would be useful and this could be achieved by asking learners to produce their own definition of tour operators and a summary of their role within the sector, perhaps producing a diagram that highlights their position within the  structure. Holiday brochures will help learners to identify how tour operators link with other component industries when providing and selling holiday packages. Links with trade and regulatory bodies and the legal framework could be researched in small groups, culminating in short, informal presentations. Vertical and horizontal integration can be a difficult concept for some learners and they will benefit from being given simple definitions, followed by practical tasks using the internet and holiday brochures to research one of the large in tegrated organisations. Findings could be presented in the form of a diagram and could then be compared with one of the integration charts that are produced from time to time by the trade press. Tutors will need to explain how the travel and tourism sector is constantly changing (which is why textbook models of integration are likely to be out of date). Learners will need to read the trade press regularly in order to keep abreast of changes of ownership and takeovers. Tutors could initiate a debate or discussion on the impact of integration to determine whether integration is a good or bad force within the sector, and about the challenges integration creates. Research activities could be developed to examine external influences including environmental, political, economic, social and technological influences. Hurricanes, the credit crunch, unemployment and terrorist activities are just a few occurrences that can present significant challenges for tour operators. A noticeboard could be created in the classroom to display any topical events or issues. Learners need to appreciate that there are hundreds of different tour operators, falling broadly into the categories of outbound, inbound, domestic, mass market and specialist. Learners, in pairs or small groups, could research to identify tour operators within each of the categories, and the range of products and services they offer. The internet is an excellent source of information, as are holiday brochures; however, tutors should discourage indiscriminate collection of holiday brochures. Learners will find that most tour operators have products and services that target different market segments and this will be reflected in some of the accommodation, travel, destination and ancillary services choices provided. Learners need to understand that all tour operators, whether large or small, carry out the same functions when planning, selling, administering and operating the holiday package. Larger tour operators may  have separate departments to carry out a particular function whereas a very small tour operator might have just one person responsible for a range of functions. A practical task could involve learners organising a college trip and relating the activities they carry out to the functions of tour operating. A visit to a large- or mediumsized tour operator would be very beneficial so that learners can see how tour operators work and how the different functions are carried out. Additional tutor input on planning, selling, administration and operations will be required. Activities using case studies can reinforce understanding of aspects such as different methods of contracting, currency considerations and pricing strategies. It is essential that learners develop a sound understanding of all functional areas. Discussions are to be encouraged to help learners appreciate commercial considerations, the difficulties tour operators have in making a profit and to identify ways in which profit can be maximised within the planning, selling, administrative and operational functions. In preparation for assessment, learners will need to practise designing and planning a package. Working in groups to a specific brief, they could practise by planning a college trip. As part of the planning, they would need to consider transport options, type of accommodation and board basis, excursions and activities. Each group could present their proposals to the class and vote on the most interesting proposals. Tutors should explain the terms ‘load factor’, ‘mark up’, ‘profit margin’, ‘fixed costs’ and ‘variable costs’ and then work through simple costing exercises to show how these terms are used. When learners have understood the process for costing a package, exercises should be designed to put this into practice. Tutors may need to devise additional exercises before learners become confident in working with these calculations.

The Awakening :: Personal Narrative Essays

The Awakening As I strolled through the door of the old stone building of the Danish Folk High School in Sønderborg, Denmark, I had no inclination of what I was supposed to be thinking. From the moment when we arrived in Copenhagen, the concept of the Folk High School was thrown at us in many different ways and I, maybe still in a wary state of jetlag, never grasped it. When we first arrived, I could not fathom the concept of a high school student finishing their studies and, en-lieu of moving on to college, chooses instead to give up a precious year of his or her life to go to a folk high school. "A school with no grades?" I balked back at a professor of mine who was telling us of the origins of the schools, "why would anyone want to waste their time going to one of them?" It was with this preconceived stereotype of mine that I reluctantly entered the building. "Bizarre," I remember as the first word spoken from my lips to a friend of mine as we were gathered in a large group together in the school's auditorium for the opening lecture. "This place reminds me of the YMCA back in my home town," I added, trying to make a common ground with something I was very familiar with in my life. It was not that I was trying to put the school down on a first judgment, for the place did in fact remind me a great deal of my local Y. With it's small, cramped dorm-rooms, musty pool and locker-room facilities, and tiny, hardwood floor gyms, it's a wonder I did not break down in a fit of home-sickness. Through the entirety of the Principal's speech, I remember wondering back to my original thought of why a high-school graduate would want to go to one of these schools. The Principal only touched upon this pressing issue of mine from a very distant perspective. He noted how the Folk High School we were currently visiting had a sports oriented curriculum, and thus most of students went on to work as a trainer or a head coach of a particular sport. I was not that naïve to believe that of the ninety plus students currently enrolled in the school, all ninety would go on to a sports related job in their future.

Impact of the Telephone Essay

If you didn’t have the telephone then how would you contact people? You wouldn’t be able to easily. If you wanted to talk to people you would have to go to their house, meet them somewhere, or write to them. That would be difficult. The world’s communication has been upgraded by the telephone. The telephone had a large impact, it made business more efficient and it saved money from having to travel back and forth from far places, and it made transactions able to occur more quickly. It led to instant communications around the world and even led to the Internet. The telephone also opened up many new job opportunities by starting new companies and building and making more telephones for the rest of the country and world. (www.learnnc.org) Before the invention of telephones, mail was a large part of life. This was mainly because it was the only way of communication. Telephones are a huge part of today’s life. As telephones became more and more advanced they also became more and more popular. Now it is the most common way of communication. (www.slideshare.net) Our modern day telephone system has made our communication system more unified. Telephone has bridged the gap of long distance communication. This expansion of the telephone can never be stopped long as the telephone business continues to build for the future. No single year in the fifty of telephone history has recorded a shrinkage in telephone use. Telephones in the United States have multiplied from Bell’s one telephone t to more than 17,000,000, or one to every seven persons in the United States and the average number of telephone conversations daily has risen from less than 8,000,000 in 1900 to 70,000,000 in 1926. (www.learnnc.org) There is no overacting, the public demand for telephone service increases with every extension and improvement of that service. Apparently, the telephone industry is destined to grow as long as the United States grows. Certainly it will continue to grow as long as individuals and groups through improved communications find it possible to increase production and sales, leisure and wages, profits and the pleasantries of life. Before the invention of the telephone, messages were sent mainly via messenger and mail. Due to the great distances being travelled to deliver  messages, only important messages were being sent. Alot of the jobs that are existent today were non-existent during the phone-less decades. For example, the telecommunications industry and the eCommerce industry were not in existence during these times. If a person needed information about goods or services being offered in the community they would ask a friend or relative, or they would get on their horses and wagons and travel down to the local business and inquire for themselves. Before the invention of the telephone, people would rarely immigrate to other places for the fear of not being able to communicate with their family and friends. Communities had more of a social setting than they do now. Strangers would communicate with each other and friends would gather to discuss the latest gossip and enjoy each others company. In current technological times, we are no longer interested in socialising with the people around us, not even our neighbors. People were more aware of their surroundings and they appreciated it more than the modern day technological society that we live in. Traditions were held up and culture expanded. How do smart phones affect in our daily lives?Research has found that smart phones satisfy all social communication needs. this lead to addiction, lack of concentration and even lack of sleep. Smart phones have a huge negative effect in the workplace, because workers can not meet their deadline. The aim of this research was to find out if it is worthy getting a smartphone? and how is it going to benefit the person buying it? Smart Phones are highly advanced and are good in multitasking, but they changing our lives in a negative way. people do not communicate as much orally and become antisocial. Students do not concentrate in class. People become addicted to the phone and dependable. These are the effects that smart phones have on us.In conclusion: as good as smart phones are the negative effects are out weighing the positives. It is hard to say whether the invention of the telephone was a good thing or a bad thing for our society. Some might argue both sides. When attacking this issue there are a lot of different facts a person has to look at before they can decide. Some of the advantages of this technology are: In the event of an emergency, the proper authority can be contacted, we can now  communicate with our family whenever we wish (this promotes strong family ties),and businesses can now spread their services throughout the world. Some disadvantages that the invention of this technology had brought about are: Loss of traditional culture, increased health problems due to radiation, lack of privacy, and increased disturbances and lack of awareness of our surroundings. Although, there is some good and some not so good effects to this invention, it is hard for me as a person of this generation to be able to imagine a picture of a world without telephones. We know that it is the most important technologi cal invention because of the length of time it has been utilized and the rate in which its use continues to grow throughout the world. I believe that it has created a more controlled environment and should continue to be utilized for years to come. Works Cited â€Å"1.5 The Impact of the Telephone.† The Impact of the Telephone. Web. 11 Mar. 2014. . â€Å"Smartphone’s and Their Effect in Society.† Smartphone’s and Their Effect in Society. Web. 12 Mar. 2014. . â€Å"The Telephone’s Impact on America – The Telephone; Impact on America!† The Telephone; Impact on America! Web. 13 Mar. 2014. . â€Å"Thoughts of An Aspiring Journalist.† Thoughts of An Aspiring Journalist. Web. 13 Mar. 2014. .

In class essay about play Antigone Essay

Creon, the king of Thebes, is one of the major characters. The author utilized several characters/ foils in order to build up the king’s image, the pride, cruel, stubborn and superior ruler. Through those conflicts, arguments and persuations, the king’s figure was gradually set up and was foreshadowing the tragic ending of his own life. The conflict between Antigone and Creon in the play is very outstanding and intense. Creon commanded that Eteocles would be buried in formal way, meanwhile, Creon also made laws to prevent people from burying Polynices. Let his corpse rot and be eaten by animals. Antigone buried the body without any hesitation that she was violating the laws. Because Antigone believed there is nothing can be superior to the gods, the gods would agree with her action. She argued that Creon, a mere mortal, did not have the power to override the gods, which enraged Creon. The things Antigone believed utterly subverted Creon’s value. In contrast, Creon thought the king’s power overtopped any other thing, all the laws he made should be obeyed no matter they were right or wrong. He also believed once the king made the decision, there is no way that the king was about to make mistake. Nobody should doubt the power of the king. Compare to Antigone, Creon was too pride of being a king, he wallowed in dominant power, forgot and betrayed the traditions of gods. The closed bonding between Antigone and Polynices also urged Antigone to decide to bury his body. Antigone said, once father, mother and brothers passed away, there would never be another one. Antigone treated the dead fairly because she knew let the body of her family rot in the desolate place was cruel, just like killing the person twice. Creon never regard Polynices was his family but a bastard traitor. He did not want to forgive his sin even though he had already received deserved punishment. Creon ignored Antigone’s argument and sentenced her to death. Once again he thought he was doing the right thing, he did not consider about the impact that would fall on Antigone’s fiancà ©, his son Haemon. Creon was cold inside his stone-like heart, which is a great contrast to Antigone’s selfless and devoted characteristic. Heamon was judicious and sensibl, not like his father Creon. Knowing Antigone sentenced to death, Haemon tried to persuade his father in a rational and  peaceful way. He brought up the general opinion from the citizens that Antigone did not deserve death. He pointed out Creon’s mistake and he would admire his father more if he could fix the situation. But Creon did not take in Haemon’s advise. Creon analysed things with a fixed perpective that he was always right. He was pride and irrational. There is no need to consider advises from lower class people, in this case, his son and his citizens. It was conventional that father gave lessons to son. Though Haemon came to argue with a positive and irenic attitude, not to pick up a fight, Cremon distorted his meaning with the assumption he was on Antigone’s side and called his son the woman’s slave. Readers would conclude Cremon was bad at controling his sentiment and was very easy to get maddened. Tiresias, the prophet also came to persuaded Creon. Tiresias encountered strange phenomenon that indicated the gods was angry about the decision Creon had made. He told Creon to change his mind. Creon found his speech so harsh and dreadful. Once again he felt his power was being challenged by other ordinary people, he doubt Tiresias’s purpose and wondered if he came for his own profit. Creon showed no repects for the messenger of gods, Tiresias, same as the gods themselves. This instance lead to the climax of the play, the gods were enraged and Creon was punished for his mistakes. The above three charaters, as the major foils for Creon, their contrasting traits exposed Creon’s peremptory ruling and cruel father image. The intense conflicts also add more tension and help with the development of the plot.

The Old Testament Belief in Life After Death Essays

The Old Testament Belief in Life After Death Essays The Old Testament Belief in Life After Death Essay The Old Testament Belief in Life After Death Essay Essay Topic: Bless Me Ultima Jaws Nashville Life and death, and much more, life-after-death constitute issues that we may never completely comprehend with our limited human intellect. The question of the possibility of an afterlife is one to which most religions have had to provide answers. Judaism, as a religion, at some point in its history had to confront this question. The aim of this essay then is to point out how the Israelites, as a religious people, came to answer this question of the possibility of an afterlife. We would notice as we progress in this essay that the ancient Jewish belief about an afterlife is one of progression from despair of survival after death to a reassuring hope of Yahweh’s justice and power to preserve the souls of the righteous from torment. The Israelite Conception of Life The concept of life that we find in the Old Testament is one that is strongly theistic. Life, first and foremost, for the Israelites of the Old Testament era, is to be understood as a gift of God. Life is God’s own creation. With the creation of the universe and all that lives in it came life. The Israelites, undoubtedly from their creation account, understood the universe as the work of God. If the universe and all that is contained in it, including man, is the work of God, then life is not something man has by virtue of himself, but something that is given him, namely a gift. The Israelites believed that man did not just begin to exist spontaneously. Man had an origin. This origin is to be located in Yahweh, the God of the Israelites. Man, as well as woman, is the creation of Yahweh. Thus, to be alive is to have been created by God. In as much as this exillic (or probably, post-exillic) creation account of the Israelites speaks of life as Yahweh’s handiwork, the Israelites, from their experiences, saw the ephemerality of this life. Hence the psalmist declares:Yahweh, what is human being for you to notice, a child of Adam for you to think about? Human life, a mere puff of wind, days as fleeting as a shadow. [NJB Psalm 144:3-4] It was in the consciousness of the Israelites that the only kind of life worth living is a life of fidelity to the one true God, Yahweh. As a convenanted people, they believed that the good life consisted in keeping he laws and precepts of Yahweh. Moses’ farewell message to his people sheds light on what the Israelites held to be the right attitude to life: obedience to the laws and precepts of Yahweh. To his people, Moses offered two options, namely life and prosperity on the one hand, death and disaster on the other hand. He enjoined his people to embrace life and prosperity by way faithfulness to Yahweh (NJB Deuteronomy 30: 15-20). Accordingly, the Israelite conception of life was shaped by their relational experience with Yahweh. The Attitude of the Israelites Towards Death Death is an inevitable end for man. The Israelites of the Old Testament period knew this much because of their experience over time with the phenomenon of death. In general, the Israelites see death as the normal term of life, hence, they only ask that they be allowed to live out their days in peace. But they elicited varied reactions to the phenomenon of death. Otto J. Baab has postulated that the common form of attitude towards death was that of indifference. He considers this manifest in the following instances, among others: the struggle between Jacob and his brother, Esau, for their dying father’s blessing without minding the fate of their dying father (Gen. 7); Moses’ defense for the established priestly order by a reaction of destruction, without sympathy or pity, against the 250 laymen that revolted against the priestly hierarchy (Numbers 16:30); and Cain’s remorseless attitude towards the death of his brother, Abel, whom he killed. The attitude of indifference here is that of blatant disre gard for what becomes of the victim of death, or better still, an attitude of life-goes-on with or without the deceased. Another form of attitude towards death was its acceptance with quiet confidence. The death of Abraham is presented in the Old Testament as one that came after a satisfying and fulfilled life (Genesis 25:7-8). Jacob and Moses are equally reported to have died at an advanced age. Joseph, at his ripe old age, knew his death was near and did not wish it away (Genesis 50:22-26). He evinced an humble acceptance of death. Yet, another form of attitude towards death is that of rejection, sadness and pain. Such sentiments are, in the Old Testament, rather connected with suspected early, sudden, and untimely death. Such kind of death is for the wise man a punishment for wickedness. We find in David’s grief and pain a typical Israelite rejection of sudden death. David went aground with sorrow, strict-fast and sack-clothing because he was opposed to the imminent death of the child he bore from his illicit affair with Bathsheba (II Samuel 12:16-25). Only in the book of Job do we find an unusual desire for death. Of course, his desire for death was precipitated by the bleakness and utter dismay he experienced in his moments of affliction, loss and desolation. In the midst of his misfortunes, Job wandered whether it was not better if he had died by still-birth or as soon as he left his mother’s womb (Job 3:11). Put differently, he thought he was better off dead than alive to live miserably with no hopes like a dead man. It may be insightful to take another look at the attitude of David towards the death of the child he begot with Bathsheba. David’s mood changed immediately he realized that the child for whose sake he had grieved and kept fast had died. His reply when asked by his retinue about his changed mood, â€Å"But now that he is dead, why should I fast? Can I bring him back again? I shall go to him but he cannot come back to me,† (II Samuel 12:22) bespeaks of a belief in a place of reposition for the dead. For the Israelites of the David’s time, the abode of the dead is sheol. The Israelites would usually locate sheol in the depths, a place of shadowy existence. Thus, it is variously described as the â€Å"depths of the underworld†(Proverbs 9:18), and the â€Å"depths of the earth† (Psalm 63:10). It is believed that sheol accepts all, kings and beggars, masters and slaves, old and young, innocent and evil doers, without distinction. It is a place, which once descended into, no one returns to earthly existence (Job 7:9-10). Its victims are kept in it pitilessly (Song of songs 8:6) and none can see the light forever (II Samuel 12:23). The Question of the Belief in Afterlife in Old Testament Thought With regard to the idea of an afterlife, ancient Israel, biblical scholars have opined, was much closer to the beliefs of Mesopotamia and Canaan than it was to the beliefs of Egypt. The Egyptian idea of an afterlife conceives of survival after death as a two-dimensional continuation of earthly human existence and not as a genuinely new and different state. For the Egyptians, the joys of the world beyond the grave are the carnal joys of normal experience. People could share in the life of the gods, but only in a purely human way. The Egyptian afterlife is thus a thoroughly secularized world. In contrast to the Egyptian belief in an afterlife is the Mesopotamian belief that there is just no hope of survival after death. For the people of Mesopotamia, the world of the dead is a vast tomb where the bodies of the dead lie inert or are no more than semi-conscious at best. Death in Mesopotamia was usually greeted with deep pessimism. It was believed that to the gods alone belonged life. It is man’s lot to die, and after death, no hope of survival because the gods do not deign it fitting that man should share in their immortality. In fact, they believed that life was meant to be enjoyed with all the pleasures that may come with it and more since there can be no sure pleasure beyond death. The Israelite attitude toward the possibility of life after death shows no appreciable difference from Mesopotamian belief. Scholars would generally hold that this belief in no hope of survival after death was expressed in the Old Testament before some of its latest passages, which were probably written in the 2d Century BC. The Israelite belief that there can be no hope of survival after death may be understood from their conception of human nature. For the Israelites, the constitution of the human person does not contain in it any principle of survival. Neither the â€Å"soul† nor â€Å"spirit† survives death. Since they believed that the soul cannot exist independently, it then means that the Israelites of antiquity understood the human person as a unity that cannot be bifurcated radically into a body and soul with the possibility of individual existence. The implication of this anthropology is that, when a human person dies, it is the whole person that dies. No part of the deceased survives. Death, thus, becomes an absolute end; and this precisely is the view of death over wide stretches of the Old Testament, especially in the earlier period of Israel’s history. As much as it could be said that the ancient Israelite conception of human nature does not support a distinction, as is often made today, between the body that perishes and the soul that survives bodily death; just as much as the very idea of sheol seems no different from the ancient Mesopotamian conception of Arallu, the world of the dead, a place where the dead lie hopelessly inert, there is some modification that could be made with regard to the ancient Israelite conception of a possible afterlife. In order words, there is reason to belief that the Israelite pessimism of non-survival at the face of death underwent a further development. There are certain passages in the Old testament that seem to suggest a latter Israelite inclination towards a belief in survival after death. The development of the idea of an afterlife probably gained a strong impetus from the emphasis prophets Jeremiah and Ezekiel began to place, at their time, upon the fate of the individual rather than the whole people. From the period of the exile onwards, it gradually came to the Israelite consciousness that the good or evil life of each person mattered before God. This led to reflections on the question of what happens to the good man who dies without recognition or blessings in this life. Would such a person be destined to the same faith as the wicked? The faintest hope of this survival may be seen expressed in Psalms 49 and 73 which reflect about the futility of wealth and the triumph of justice respectively. In both instances, the psalmist points out the universality of death, yet we see in each a ray of hope for the preservation of the righteous. The righteous, though mortal by their human nature, cannot come to the same end as the wicked, otherwise the exhortation to be righteous is needless and unrewarding. Psalm 49 speaks of Yahweh ransoming the souls of the honest and righteous from the clutches of sheol to which the wicked and avaricious are held bound (Psalm 49:1). The idea of preservation from the jaws of sheol that the psalmist speaks of can scarcely mean that the righteous will not experience death. This conclusion has already been precluded by the admission that death comes both to the righteous and to the wicked. With regard to Yahweh’s preservation of the souls of the righteous, the psalmist apparently strikes upon communion with Yahweh, the experience of happiness, and not dejection, that comes from having lived well on earth. The psalmist came upon this conclusion from the premise that Yahweh must have some way in which communion with him can be preserved for those who are faithful to him; otherwise there would ultimately be no difference between righteousness and wickedness. But this idea was not fully developed here, partly because of the ancient Israelite conception of human nature and human life, which knows of no principle that could survive death. When the hope for survival after death came be to expressed, the only possible form that it could take in the Israelite thought was the resurrection of the body. The first clear expression of this hope of resurrection took place in the Maccabean period of persecution and martyrdom with these words: Of those who are sleeping in the Land of Dust, many will awaken, some to everlasting life, some to shame and everlasting disgrace. Those who are wise will shine as brightly as the expanse of the heavens, and those who have instructed many in uprightness, as bright as stars for all eternity [NJB Daniel 12:2-3]. Still another expression of this belief in life after death is found in the Book of Wisdom probably written in Alexandria in the first Century BC:But the souls of the upright are in the hands of God, and no torment can touch them. To the unenlightened, they appeared to die, their departure was regarded as a disaster, their leaving us like an annihilation; but they are at peace. If, as it seemed to us, they suffered punishment, their hope was rich in immortality; slight was their correction, great will their blessings be [NJB Wisdom 3:1-4]. The history of the development of this Israelite idea of resurrection in not completely clear. Nevertheless, it could not have been an idea that evolved out of nothing. A good number of Old Testament scholars think it is very probable that this change in the Israelite conception of afterlife is not without Persian and Greek influences. Perhaps, what we find quoted above from the Book of Wisdom proves a decisive Greek influence in the Israelite ormation of the conception of the immortality of the human spirit. This belief saw a greater appreciation in later Judaism and, subsequently, in Christianity. Conclusion The life man has was given him by God at creation. However, man’s life on earth as a matter known from experience has to terminate at some point. Death ends its all for the Israelites of antiquity. Death does not discriminate against the wealthy or poor; nor does it discriminate against the upright or wicked. It affects all and sundry. The Israelite knew this much to be true of death. Initially, they believed death was an absolute end and that the dead are consigned to a place where they are forever inert, namely sheol. However, this view had to undergo modifications over time, partly due to probable Persian and Greek influences, and partly due to a better understanding of Yahweh’s justice. Thus, the Israelites of old were led to understand that there is another life beyond death. Christians today can boast of a robust belief in a flourishing life after death because it has become a heritage revealed through the person of Christ, the only Son of God. BIBLIOGRAPHY Baab, J. Otto. The Theology of the Old Testament. New York: Abingdon Press, 1949. Boadt, Lawrence. Reading the Old Testament: An Introduction. New York: Paulist Press, 1984. Heinisch, Paul. Theology of the Old Testament. Minnesota: The North Central Publishing Company, 1955. McKenzie, L. John. â€Å"Aspects of Old Testament Thought,† The New Jerome Biblical Commentary. Edited by Raymond Brown et al. New Delhi: Indira Printers, 2007, pp. 1284-1315 Rad, Von Gerhard. God at Work in Israel. Translated by John H. Marks. Nashville: Parthenon Press, 1980.

How to Find Writing Assignments As a New Freelance Writer

How to Find Writing Assignments As a New Freelance Writer Any person who decides on a freelance writing career has to start at the beginning. I mean starting out with no clips of their work, no endorsements, and an uncertainty of where they are going to find an offer to write. I’m sure you have read many stories about new writers dealing with questionable companies and websites that offer ridiculously low sums of money. How then should you go about getting those great first assignments? I started out like everyone else with no previous articles and was basically unknown when I was offered my first writing job. And I didn’t look for the job . . . the company came to me. I started out writing a blog and making sure that several social media sites saw my work. I linked my articles to Twitter, Facebook, LinkedIn, and many other social websites. The goal was to place each article where it made the most sense. If I wrote a parenting topic, Mommy Bloggers got a link. If I wrote about blogging itself, there were a few blogging groups on LinkedIn that would see my article.   In fact, it was because of those articles on Linkedin that I landed my first job. A company saw what I was writing on a LinkedIn group, saw how people in the group were interacting with what I wrote, and decided I would be a good fit for them. They asked me to write a 300-500-word article on a financial topic. My very first assignment, and it landed $65 in my pocket. I had no clips. I hadn’t even been a guest writer on another website. Of course that might just be considered a lucky break.   What should you do if you aren’t being approached Once you have been writing and sending out articles for a while, your next step is to ask for the job. All of that social networking hopefully has created a strong following of readers. Take the time to write to these readers and ask if you can be of assistance to them. Look through your Facebook, Twitter, and LinkedIn  contacts and take a look at the company they work for and what their job title is.   If they seem to be a decision maker, who might hire the freelance writer and more importantly, need a freelance writer, I email them. I let them know what I feel I could do for their company. Suggest writing blog articles or a press release for the company. Make sure your offer makes sense to the person you write to. If you have knowledge about finance and you are writing to a financial company, tell them what your background is and why you would be a great choice for writing their articles. Personally network with people in your community. Join your local Chamber of Commerce, the PTA or even a writing group through Meetup. You never know who has a need for your skills or who might have great advice where to seek a job. Finally, if you feel more comfortable starting your career Writing Sites: Mediabistro.com Indeed.com Journalism Jobs.com Freelance Writing Gigs.com Skyword.com Elance.com Writer Access.com Problogger.com BloggingPro.com FlexJobs.com iWriter.com Jobrapido.com oDesk.com I hope the information provided helps you out in your own career.

Analysis of Impeachment Trails Essay Example | Topics and Well Written Essays - 750 words

Analysis of Impeachment Trails - Essay Example reflect negatively on the integrity of the US government while at the same time, taking no action will be taken as a laxity which would affect trust and relationships as well as granting the future holders of this office chance to abuse their powers (Stadelmann, 2011). The most unethical of the three cases is the Nixon’s case with the Watergate issue where he covered up and refused to hand over evidence of the Watergate affair which would have shown that his re-election committee burglarized the headquarters of Democrats party office headquarters. He used his powers to misuse the CIA, conduct illegal wiretapping, perjury and obstructed justice. Lucky for him he resigned before he was impeached. This is closely followed by Clinton case. His sexual encounters were not what led to his impeachment by the Congress but rather his perjury and abuse of office. He was a lawyer to begin with and he knew that lying under oath was the worst mistake that can be done through any trial. Lastly is Andrew Johnson’s case where immediately after the Tenure of Office Act was enacted in 1867 and whose aim was to prohibit presidents from removing from office holders without approval from the Senate, he still went ahead and tried to remove the Secretary of War Stanton. He then went ahead and criticized Congress in loud voices on top of using his office to abuse powers (Gerhardt, 2000). On Clinton, the ethical charge would be conducting misconduct by having sexual relations in office which amounts to extra marital affairs and lying about it even after having video evidence of the misconduct. As for the Andrew Johnson, the ethical charge would be abuse of power and going against the laws of the land which he is supposed to be on the forefront of protecting. When it comes to Nixon, there are several ethical charges the first being perjury, abuse of his power as a president and involving the CIA in crime as well as misconduct in office by harbouring criminals and refusing to cooperate

Fire Protection Hydraulics and water supply Essay - 2

Fire Protection Hydraulics and water supply - Essay Example Conversely, the elevation pressure must be decreased in order to maintain the level of the forward pressure. These adjustments are done by controlling the flow and turning the nozzle in order to get the elevation pressure required. To relieve the backpressure, the nozzle is turned downward, while in order to relieve the forward pressure, the nozzle is turned upward (Cote, 2003). In a Fire protection system, the backpressure and the forward pressure must be properly controlled in order to maintain a particular quantity of fluid that passes through the nozzle. This is done effectively by controlling the elevation pressure (Cote, 2003). If the backpressure and the forward pressure are not adequately controlled, the fire protection system would definitely not function properly. In essence, the knowledge of the amount of elevation pressure that is required to produce a particular amount of backpressure and forward pressure is of high importance as this would go a long way in making the fire protection hydraulic system more

Project Communication Term Paper Example | Topics and Well Written Essays - 250 words

Project Communication - Term Paper Example The first thing we can do is pair people into groups of four, two of each. This lets each person feel they have someone who understands them while having to work with two who are coming from a different place. Second, when were doing user group instruction or teaching, we should again have paired elements. The introverted person can handle some of the electronic communication, while the extroverted person can do some of the speaking portion, but both should be involved at each step. When an introverted developer gets a chance to answer a question about how his programming works, his area of expertise, hell come out of his shell quickly more often than not. Finally, we should use a message board and a wiki. This not only lets us keep up in real time with our user group, but it also lets the introverted people have a chance to discuss in a forum that lets them apply their thinking

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

Animal Farm Summary :: Animal Farm Essays

The book starts in the barnyard of Mr. Jones' "Manor Farm". The animals gather at a meeting led by the white boar, Major. Major shows them that no animal in England is free. He also explains that the stuff that they produce is taken by man and the animals do not benefit. The only thing that man gives is food to survive so more money can be made off of the animals. Majors lets them know that man is the source of all problems and should be eliminated. He proposes that all of the animals should avoid man's habits. Above all Major says to the animals that they cannot kill one another, that they are all equal.A few days later Major dies, but his message remains in the hearts and minds of the animals. Under the leadership of the pigs, who are clearly the more intelligent of the animals, they strike against their human master and manage to get rid of him. After the rebellion, under the direction of Napoleon, the most outspoken pig, and Snowball, the most articulate pig, the animals continue to work the farm with success.The animals now come up with a set of rules to run their society. They are labeled "the Seven Commandments of Animalism" and are posted on the barn wall. 1. Whatever goes upon two legs is an enemy2. Whatever goes upon four legs, or has wings is a friend.3. No animal shall wear clothes.4. No animal shall sleep in a bed5. No animal shall drink alcohol6. No animal shall kill any other animal.7. All animals are equalThe animals succeed at running the farm for a little while. They finish all of their work with stunning efficiency and every week hold ceremonies to celebrate the rebellion and to plan work. Meanwhile, the pigs as leaders are taking bigger food rations for themselves justifying their behavior as something necessary for the "brains" of their animal society. They explain that it is necessary or else the farmers might come back and take over the farm.The farmers do try to reclaim their tries to reclaim his power but the animals prevent him from doing so in what they call "The Battle of the Cowshed". The conflict between Napoleon and Snowball gets more intense. At every meeting they can never agree on what needs to be done. Napoleon and Snowball fight over whether or not a windmill should be built.

Progressive Taxation

Progressive taxation rates are unethical and need to be changed. The media likes to say the rich need to pay their fair share and I will show that if everyone paid the same percentage of their income without all the loopholes the current tax system has the government would be better off. This is an ethical issue that needs to be addressed by our current and future leaders to help eliminate the extraordinary amount of debt our country currently has to reimburse. Utilitarianism is that an action is right if it tends to promote happiness and wrong if it tends to produce the reverse of happiness [1].It also involves the happiness of the performer of the action but also that of everyone affected by it. This would lead the current system of progressive taxation since those involved in creating the current tax system believe it is fair to all involved. The poor would see the rich pay a higher percentage of their income to fund the government and the items that they provide. Unfortunately th is country has been using this type of taxation and now it has a tremendous debt to repay. So our current taxation system must not be working if we are not taking in the amount needed to pay our yearly government expenses.Relativism is the belief that everyone has their own version of the solution to the problem. It is also a concept that states points have no truth or validity, but only a subjective value [2]. The discussion of progressive taxation is not one that many people want to change. Everyone that thinks a fair taxation of a flat percentage is afraid it will not promote happiness among those that would have an increase in taxes. This theory would allow us to give the chance to try a flat tax to see if indeed it would increase the income this country generates along with removing tax loop holes allowing some people to avoid paying what they should.My view is more of the relativism type of view. I believe that for our country to avoid a horrible financial crisis we must try t o generate more income and everyone must pay their fair share which would be of an equal percentage of their income. Progression has been  in use somewhere in the world for thousands of years. It is safe to say the debate on its merits goes back at least that far. At the present most nations employ some form of progressive taxation. The first time there was a federal income tax it was imposed in 1861 as a means of financing the Civil War.The tax rates were decreased after the war and the income tax was allowed to expire in 1872. The concept of an income tax was controversial so when a new income tax was levied in 1894 it was challenged in the courts. In 1895 it was found to be unconstitutional. It was not until 1913, with the ratification of the 16th Amendment to the Constitution, that the first constitutionally sanctioned income tax was enacted. The first income tax was a progressive tax [3]. Today, we Americans are paying the highest taxes in our nation's history. The current ta x system is complex and includes several inequities.It penalizes those who are married by making them pay higher taxes than single individuals. Many Americans face a death tax that will claim a large portion of their estate after they die. We need to get rid of our confusing, unfair tax code and replace it with a simple flat tax with one rate with no deductions or special interest loopholes [4]. The overly complicated tax code creates an unnecessary burden on all Americans, with an annual compliance cost estimated to be $365 billion. The extensive nine million plus word document is complex and unfair.It inhibits saving, investment, and creating jobs along with imposing a heavy burden on American families. At the same time, the tax code reduces economic growth. The code is so complex with all of the deductions, credits, and other preferences added to the tax code by the special interest lobbyists. It is because of these loopholes, taxpayers with similar incomes can end up paying diff erent amounts in taxes. This uneven treatment of taxpayers is fundamentally unethical and is not part of the American value of equality under the law.The tax code should be replaced with a new code that is simple to understand, has low rates, that is flat and fair. The new flat tax as outlined in Heritage’s ‘Saving the American Dream’ plan, would replace the current tax system with a simple tax system that would allow America to achieve its full economic potential [5]. It has to be honest in order to help promote economic growth. It will do this while removing disparities in the tax code at the same time. The existing tax system is wrong, especially in its complication and its decrease of our economic audacity.The tax system is complex and it is forced upon all taxpayers. The low income must journey thru the extremely hard to understand Earned Income Credit. Those who can save some money must overcome the loss of confidence and go through the hassle of trying to understand the tax rates and manage the different forms of saving. Businesses investing in new equipment must pay extra to get equity capital and must then overcome the tax hurdles added on their vested interests. This results in a deranged tax system which results in a much smaller economy. The need for tax reform is clear.The tax reform proposals such as the traditional flat tax would only solve part of the problem by regenerating or changing the federal individual and corporate income taxes. A new flat tax would replace income taxes, as well as the death tax, payroll taxes and all tariffs not set aside for a trust fund. Under a flat tax taxpayers will handle a single tax. The design of a flat tax is because of the need for a more rational tax system. Unavoidable high tax rates combined with unethical rules have altered the economic decisions of businesses and families. This leaves the economy in a complete weaker position by these perversions.We need a stronger economy and that i s the goal of a flat tax. It would obtain this goal by achieving an economically neutral tax base and by lowering the tax rates. The amount of taxation and the degree of redistribution are questions that will need to be answered and be separate from the primary question of taxation. Simulations have suggested a flat tax would meet this test of generating enough revenue and would leave the allotment of the federal tax load fundamentally unchanged. A better economy would create more jobs, increased wages and greater economic safeness.The economy has enjoyed economic growth in recent decades along with too many recessions and high unemployment. While this has been happening China and India are regularly gaining strength, and America must act to match their rise. Tax reform would be a good place to start in gaining and advance America’s economic strength for the years ahead. The federal tax code is very complicated and hard for most to understand. Thanks to personal computers and tax software it has created an issue with policymakers in Washington to create tax complexities that tax professionals can have issues understanding.There are too many credits, exemptions and deductions and many of them are subject to special rules and only are allowed at certain amounts of income. With all of this complexity individual taxpayers suffer minor compared to the outrageous rules and exceptions businesses suffer thru. As bad as the complexity is the drain on the economic system by our federal tax system is worse. High tax rates have discouraged all levels of productive activity. Our corporate income tax rate is almost the highest in the industrialized world and higher than the average of our international competitors. The economy is further decreased y the existents system’s impulse to overtax saving which means people are discouraged from saving enough for their retirement and for the large investments. This steers consumers toward debt and everyone towards an a bbreviated economic security. These reactions will lead to a depressed level of national savings which will lower investment opportunities. The federal tax system should not be this hard to understand and damaging to the U. S. economy. It is this way because for many decades Congresses have twisted the system often creating two new issues while trying to solve one issue.The income tax has turned to be a bad decision from its outset. After many Congresses it continues to get worse without any exceptions. A stronger economy would be a vital role in advancing the federal finances. This would create better levels of tax revenue and create less spending needs for the unemployed. A strong economy offers increased wages and increased job opportunities to the citizens of our tax base. This would create less poverty and with less poverty comes fewer demands for welfare. A flat tax would be a complete reform of the entire federal tax system as with most previous tax reform proposals.The flat tax can be started as a single tax plan or as part of a more complete rewriting of our government’s federal fiscal policy. A flat tax would offer astounding understanding for individuals and businesses. It would create much greater clarity so that we taxpayers would be more convinced the taxes that are paid are in close to the amount of their neighbors. It will also allow taxpayers to be more informed about the costs of running our government. The flat tax will free the potential for the American economy to grow without being burdened by high tax rates.American taxpayers spend an average of 26. 5 hours processing and preparing their tax returns [6]. However companies and wealthy people hire teams of professionals to play the system. How is that fair? A flat tax treats everybody the same. You don’t have to worry about missing deductions that the other guy is taking. Other countries in the world have adopted the flat tax, even former Communist countries. Why can’t the United States? Those other countries have understood that a flat tax reduces the incentive to play the system.Because of its simplicity and low tax rate, a flat tax encourages people to stop cheating and honestly report their income. They can be assured that both the rich and the poor are paying the same rates and taking the same deductions. We save time and money and make our country more competitive in the world. A flat tax would replace our existing tax system with a very simple single rate system that would only tax individual’s incomes only once, offers businesses with an economical investment-friendly tax, and replace all federal income taxes along with payroll taxes.This will prove that progressive taxation rates need to be eliminated to allow for a fair and balanced tax rate that all Americans can feel is fair. We do not need to be overtaxed, but equally taxed. We need to save our country from bankruptcy and save it so our children’s children will have a p lace to call home. We need to keep America the greatest country in the world without having the future generations force to pay even higher taxes because our government officials can’t stop spending the money they do not have to spend. 1 – www. utilitarianism. com – Stanford Encyclopedia of Philosophy, plato. stanford. edu 3 – Hoover Institution, Stanford University, www. hoover. org/publications/policy-review/article/72291 4 – Freedom Works, www. freedomworks. org/issues/flat-tax 5 – The Heritage Foundation, www. heritage. org/research/factsheets/2012/01/the-new-flat-tax-encourages-growth-and-job-creation 6 – David Keating, A Taxing Trend: The Rise in Complexity, Forms, and Paperwork Burdens (National Taxpayers Union, April 18, 2011), 13. Available at: http://www. ntu. org/news-and-issues/taxes/tax-reform/ntupp130. html (April 20, 2012)